Rule `sbcd2chip`¶

Purpose¶

The sbcd2chip rule is designed to create a spatial barcode map for a chip section of interest. It achieves this by merging the spatial maps of all tiles corresponding to the chip, guided by a spatial barcode layout file.

Input Files¶

Per-Tile Spatial Barcode Maps & Flow Cell Manifest Required inputs are the spatial barcode maps for each tile associated with the chip of interest and the manifest file for the corresponding flow cell. Both inputs are generated by the fastq2sbcd rule.
A Spatial Barcode Layout file It is optional to provide a specific spatial barcode layout file for the chip via the job configuration file. If absent, NovaScope will use the spatial barcode layout provided by the NovaScope repository.

Output Files¶

The rule generates the following output in the specified directory path:

1	`<output_directory>/seq1st/<flowcell_id>/nbcds/<seq1st_id>`

(1) Per-Chip Spatial Barcode Mape¶

Description: This is a compressed, tab-delimited file mapping barcodes to global spatial coordinates on the chip, with duplicate barcodes removed. Note that only one spatial barcode map is produced for a chip, both lane ID and tile ID are set to 1.

File Naming Convention: 1_1.sbcds.sorted.tsv.gz

File Format:

AAAAAAAAAAAAGCGACCGGGTAATATATGT 1   1   1413111 2277603 1
AAAAAACATAAGAAAGATCCAAATGACGGTC 1   1   871865  383588  1
AAAAAAGGTACCCGCAGTGCGGACAAACGAA 1   1   1214343 1498113 1

Column 1: Spatial barcode sequence (HDMI, typically 32 base pairs).
Column 2: Lane ID, which is defined as 1.
Column 3: Tile ID, which is defined as 1.
Column 4: X-coordinate within the chip (global X-coordinate).
Column 5: Y-coordinate within the chip (global Y-coordinate).
Column 6: Count of occurrences for each spatial barcode.

(2) Per-Chip Manifest File¶

Description: The manifest file offers summary statistics for the chip of interest.

File Naming Convention: manifest.tsv

File Format:

id   filepath                 barcodes  matches  mismatches  xmin  xmax     ymin  ymax
1_1  1_1.sbcds.sorted.tsv.gz  5962994   5962994  0           0     1469211  0     2277916

id: The id is composed of <lane_id>_<tile_id>. Given only one spatial barcode map is created for a chip, the ID is designed as 1_1.
filepath: The file name is the corresponding spatial barcode map.
barcodes: The number of barcodes in the chip.
matches: The number of barcodes that match to the expected pattern.
mismatches: The number of barcodes that do not match to the expected pattern.
xmin: The minimum x-coordinate in nanometers across all barcodes in the chip (i.e., minimum global X-coordinate).
xmax: The maximum x-coordinate in nanometers across all barcodes in the chip (i.e., maximum global X-coordinate).
ymin: The minimum y-coordinate in nanometers across all barcodes in the chip (i.e., minimum global Y-coordinate).
ymax: The maximum y-coordinate in nanometers across all barcodes in the chip (i.e., maximum global Y-coordinate).

(3) An "sbcd" Image¶

Description: An image to show the distribution of the spatial coordinates of the barcodes, alongside the fiducial marks.

File Naming Convention: 1_1.sbcds.sorted.png

File Visualization:

(4) A Summary for Duplicate Barcodes¶

Description: Each duplicate barcode reports its count and the maximum distance between duplicates, provided it falls within the dup_maxdist threshold.

File Naming Convention: dupstats.tsv.gz

Output Guidelines¶

Recommended review steps: 1. Examine manifest.tsv to ensure there are a sufficient number of matched barcodes, and all mismatched barcodes are removed. 2. Inspect 1_1.sbcds.sorted.png to verify that fiducial marks appear empty and align with other fiducial marks both horizontally and vertically.

Parameters¶

The following parameter in the job configuration file will be applied in this rule.

upstream:
  sbcd2chip:
    gap_row: 0.0517
    gap_col: 0.0048
    dup_maxnum: 1
    dup_maxdist: 1
  visualization:
    drawxy:
      coord_per_pixel: 1000
      intensity_per_obs: 50
      icol_x: 3
      icol_y: 4

The sbcd2chip Parameters Those parameters are used to pass values to the combine_sbcds function in spatula. Below, for each parameter, the corresponding parameters in spatula, description, and the default value in NovaScope are provided.

Parameter	`spatula` parameter	Description	Default Value
`gap_row`	`--rowgap`	Extra gap between rows, based on tile height, for spatial adjustment.	0.0517
`gap_col`	`--colgap`	Additional gap between columns, based on tile width, for spatial adjustment.	0.0048
`dup_maxnum`	`--max-dup`	Allowable duplicate count for each barcode, within `dup_maxdist`.	1
`dup_maxdist`	`--max-dup-dist-nm`	Max distance for duplicates, in nanometers.	1000

The visualization Parameters Those are parameters for the draw-xy function in spatula.

Parameter	`spatula` parameter	Description	Default Value
`coord_per_pixel`	`--coord-per-pixel`	Coordinates per pixel, as a divisor of input coordinate.	1000
`intensity_per_obs`	`--intensity-per-obs`	Intensity of points per pixel, max 255.	50
`icol_x`	`--icol-x`	(0-based) index of X coordinate in input TSV.	3
`icol_y`	`--icol-y`	(0-based) index of Y coordinate in input TSV.	4

Dependencies¶

Rule sbcd2chip is designed to process data that Rule fastq2sbcd generates. Therefore, if the input files are not available, sbcd2chip depends on the successful execution of fastq2sbcd to function correctly. An overview of the rule dependencies are provided in the Workflow Structure.

Code Snippet¶

The code for this rule is provided in a02_sbcd2chip.smk

Rule sbcd2chip¶